avatarScienceDuuude

Summary

The article details the journey of a COVID-19 nasal swab from collection to the detection of the virus through RT-PCR.

Abstract

The article provides an in-depth look at the process that follows once a nasal swab is taken for COVID-19 testing. It begins with the collection of the sample, where a nurse seals the swab in a tube to preserve the viral RNA. The RNA is then extracted using reagents like Trizol, which denatures proteins and protects the RNA from degradation. The extracted RNA is converted to DNA using reverse transcriptase, an enzyme derived from retroviruses. This DNA, known as cDNA, is subsequently amplified using the polymerase chain reaction (PCR) with primers specific to SARS-CoV-2 sequences, allowing for the detection of the virus among other genetic material. The article emphasizes the specificity and sensitivity of the RT-PCR test, despite the challenges posed by RNA's fragile nature and the presence of RNases.

Opinions

  • The author humorously likens the nasal swab collection process to a dramatic action scene, highlighting the length and invasiveness of the swab.
  • The article suggests that the psychological impact of the test can be significant, with the author expressing fear of the swab's size and the testing process.
  • The author conveys a sense of awe at the intricacies of viral structure and the sophistication of the human immune system, particularly the role of antibodies in detection.
  • There is an acknowledgment of the potential for false positives in antibody-based tests, leading to a preference for RNA-based testing methods.
  • The author expresses admiration for the scientific process, particularly the use of a viral enzyme (reverse transcriptase) to convert RNA to DNA, which is akin to "spy versus spy" tactics.
  • The article underscores the importance of PCR primers in ensuring the specificity of the test, capable of distinguishing between closely related viral species like SARS-CoV-1 and SARS-CoV-2.

The Secret Life of Your COVID-19 Nasal Swab

What really happens behind the scenes…

Nasal swab test being conducted with a little resistance from the subject (Photo by Bernd Viefhues on Unsplash).

Despite the outstanding achievements of the international biotechnology industry’s record-blasting development of the COVID-19 vaccine, we must continue wearing masks, social distancing, and taking those pesky nasal swab tests for most of 2021. For many of us, once that swab has left the warm, moist confines of our nasopharyngeal cavity, we don’t think about it again until we get that email ping notifying us of a (hopefully) negative result.

But what really happens to that swab? How does the medical-industrial complex so quickly decide the contents of that email form letter?

I’ll uncover some of those spicy details for you here.

Martial swabs…

I’ve watched a number of these nasal swab from afar, peeking voyeuristically while I parked my car in the garage, so I know exactly how these tests go. It’s like this…

I’ll drive up to the test station — really just a couple of hastily erected tents and tables just inside the parking garage. I’ll wait behind dozens of other cars and then pull up a little more and get my appointment confirmed and wait some more. Eventually one of the gowned, shielded, and masked nurses will approach me and ask some questions and fill out a form and I’ll wait some more. Then, just when I am about to drive away in frustration the nurse will commandingly yell at me to “Stop!” as she draws a 10-foot-long cotton swab from her shoulder holster, like Angelina Jolie in a kickass movie, and twirls it martially and artfully as she runs towards me, and through the driver’s side window she plants the swab in my nose and pole vaults over my car.

Really.

Nurse at my COVID-19 test station ready to take a nasal swab (Wikimedia Commons)

I know, the psychologists among y’all are having a field day with this waking COVID-dream of mine. But this is what I see every time I park the car, these are facts. Not fantasies.

I am terrified of that swab. It is as long as my head is wide. They could swab both of my ears at the same time with that thing.

The swab tests at my work have gotten less terrifying with time, and I’ve written about the weekly tests here:

But once they finish swabbing, what happens next to the swab during the test, after I drive away with my head mummified in gauze to stanch the mortal swab wound?

Breaking down a virus…

The very first thing is that the nurse immediately puts the swab into a plastic tube and seals a cap in place to keep out contaminants. A printed self-adhesive label with your information goes onto the tube so the medical-industrial complex knows where to send you COVID test results.

I know we’ve juuust started… but before we go any further, let’s take a quick look at the coronavirus afflicting us right now. This is so we know what it is we’re trying to test for. Here’s a cartoon image of a coronavirus and I want to focus on the cross-section image on the right:

Cartoon of SARS-CoV-2. From Wikimedia Commons.

That figure is essentially a parts list for a virus. If we want to test for any pathogen, we ideally want to detect whatever makes it unique and is easy to find. One possibility is that we can test for the unique or distinguishing proteins such as the large spike proteins protruding from the virus forming the pink corona in the cartoon. Speaking of pink coronas, my kid asked if viruses have color — a great question. But unfortunately for those with a great fashion sense, viruses are smaller than the wavelength of visible light, so they do not exhibit color in any way we can perceive.

Back to detecting proteins uniquely… a great way to do that is to use efficient biological detectors from our immune system — antibodies. (Actually, we raise antibodies for testing from animals like mice, rabbits, and goats — humans raise antibodies for their own personal use.) But antibody-based tests can be a little finicky and are notorious for a high rate of false positives — meaning the test says you have the virus (positive) but the test is wrong (false).

I have some personal experience with antibody tests as I am sure many of you do. I have had Lyme disease (caused by a bacterium called Borrelia burgdorferi transmitted by deer ticks), and the usual test is a Western blot whose goal is to detect burgdorferi proteins in your blood. Here’s how the Western blot goes.

First, the proteins from your blood are run on a gel which sorts the proteins in a size-ordered array (big proteins at the top, small proteins at the bottom). We know how big the burgdorferi proteins are — but there are many proteins of similar size so we need something more specific than size alone.

Then the proteins are transferred from the floppy, fragile gel to a more robust plastic membrane and then an antibody against the burgdorferi proteins can be applied to the membrane. If the antibody attaches to the burgdorferi proteins affixed to the membrane, that antibody in turn can be detected by a second antibody which binds to and amplifies the first antibody.

A light-emitting marker attached to the 2nd can be detected by a camera. No light means no Lyme disease. A light band at the correct size might mean you have Lyme. Since these tests are prone to false positives, the CDC has recommended a two-step diagnosis starting with a 1st screening test in which a negative result is reliable and no further test is required. IF the 1st test is positive then it is followed by a second test in which multiple positives are required for a positive diagnosis.

Whew! A mess, right? These antibody assays are not quick and reliable tests.

What else can we look at in the virus as a target for a test?

The coronavirus envelope (the hollow red spherical part in the above figure) is actually derived from part of the host cell’s membrane. When the coronavirus blebs out of the human cell, the human cell membrane wraps around the viral RNA creating the finished viral particle. Therefore, the envelope is not at all diagnostic. The proteins embedded in the viral envelope of course could be the target of a diagnostic test, but those would have the same problems as the other proteins we discussed above.

The last thing we can really focus on as a target for a good diagnostic test is actually the best one — and that is the virus’s RNA. The RNA encodes all the protein needed by the virus, and embodies all the information which makes the virus unique. Furthermore, test methods for detecting specific RNA sequences are routine and fairly fast. Although RNA is the best diagnostic target it is not perfect.

There are a few bad things (when I say bad, I mean unfortunate, not morally bad) about RNA… first, look at where the RNA is located. It is protected by the envelope and a lot of protein. Another bad thing is that RNA is very fragile and degrades quickly by natural chemical degradation. Even worse, since RNA viruses have been with us since the beginning of time, evolution has ensured that every single cell and organism has designed innumerable ways to detect and destroy RNA. We have a whole suite of proteins called ribonucleases (or RNases for short) whose job is to destroy RNA. RNases exist on our skin, in our saliva, every cell in our body makes them, and they are among the toughest proteins to destroy. While these issues are “bad”, they are manageable.

We’ll see that available test methods are able to address and manage these various issues.

Isolating the viral RNA…

I believe the reagent in the tube that the nurse puts the swab into after mopping out my nose is similar to what I use in my research to extract RNA from the yeast cells I work with. The trade name is Trizol, and it contains the key ingredients guanidinium isothiocyanate and acid phenol.

Alternatively, Angelina, I mean the nurse, may put the swab into a dry tube, and when it is received by the lab, the technician may put the business end of the swab into Trizol.

The core function of the guanidinium isothiocyanate is to denature or melt proteins in an RNA preparation. There are a couple important effects of guanidinium isothiocyanate. One effect of protein denaturing is to break open cells. Mammalian cells are relatively fragile things, unlike the yeast in my lab which requires shaking with ceramic beads to beat the living bejeebubs out of them to release their contents. In contrast our cells are soft watery bags of stuff held together by protein scaffolding, and so a chemical like guanidinium that denatures proteins is sufficient to break open cells (and similarly coronaviruses). A second effect of protein denaturation is that, since RNases are proteins, this guanidinium isothiocyanate effectively protects the RNA from biological degradation. See? Right away we are managing the issues we raised about RNAs.

Acid phenol is used to separate RNA from DNA based on the differences in their chemistry. RNA at low pH prefers to associate with water, while DNA at low pH prefers to associate with an organic solvent. If we add chloroform to the mix and spin the solution in a centrifuge, the aqueous and organic phases separate: RNA remains in the clear aqueous solution which sits atop a red organic solution containing the proteins and DNA.

We can now carefully extract the aqueous solution which has purified RNA leaving the DNA and proteins behind. We have purified intact RNA.

Now we’re ready to test.

Converting viral RNA to cDNA…

The first thing we need to do is to convert RNA into DNA so we have a stable molecule to work with, and that we can easily analyze. Although we removed the RNases that enzymatically digest our RNA molecules, RNA is still liable to chemical degradation as well.

Here’s the fun thing. In order to convert RNA to DNA, we use a viral enzyme called reverse transcriptase. It’s kind of like spy versus spy… using a virus to catch a virus.

Reverse transcriptase from a white retrovirus being used to detect the black coronavirus causing COVID-19 (Wikimedia Commons)

There are some fascinating viruses called retroviruses, which are RNA viruses that are able to make DNA from their RNA, and insert that newly made viral DNA into the genome of their host. An example of a retrovirus is HIV. About 5–8% of our genome is comprised of “fossilized” retrovirus sequences that in the past have become trapped in our DNA.

Normally transcription goes from DNA to RNA. Messenger RNA (mRNA) is made by an RNA polymerase which uses a DNA as a template to make the RNA.

That is why we call the retrovirus’s enzyme a reverse transcriptase, because it uses RNA as a template, and makes DNA from it.

So, in our assay, we take the retroviral reverse transcriptase enzyme and make DNA from the coronavirus RNA (and all the other human and bacterial and other RNAs that came along with the sample).

We often abbreviate the reverse transcription reaction as “RT”.

And to distinguish the DNA we made from RNA from native DNA from our cells, we call this complementary DNA or cDNA. We will see an example of a complementary pair next when we talk about primers binding to a DNA sequence that is complementary to the primer sequence.

Now that we have a bunch of cDNA from human, bacteria, viruses, and who knows what else was lurking in my nose goop, how do I pick out cDNA specific to possible SARS-CoV-2?

Testing the cDNA for a specific viral sequence…

Here we use a classic laboratory method and this time I’ll tell you the abbreviation up front: PCR. That stands for polymerase chain reaction. But here’s a quick visual to explain what that means:

Graphical summary of a generic PCR reaction (Wikimedia Commons)

Many of you have heard of PCR, or polymerase chain reaction. But let’s break it down some.

Polymerase refers to an enzyme all living things have which we need for DNA to replicate. We need to replicate DNA so cells can divide, so we can pass our DNA to our kids, to repair DNA damage, etc. So, we are talking about DNA polymerase which makes new DNA molecules from a DNA template (previously we talked about a viral reverse transcriptase which makes DNA from an RNA template).

The idea of a chain reaction is conceptually straight forward. Right? When we think of a nuclear chain reaction, for example, we think of a single uranium-235 atom which splits (fission) and gives off energy plus 3 high-energy neutrons. Each released neutron causes another U235 atom to split and which releases 3 more neutrons for a total of 9. Those 9 neutrons each causes fission in another U235 so we have 27 neutrons released, and so on and on for an exponential and ultimately explosive reaction.

Similarly, for PCR, the polymerase enzyme makes a DNA copy of the original cDNA. Then the next round, a copy is made of each of those for 4 copies. In the 3rd round a copy is made of each of those 4 copies, for a total of 8 copies… and we have another exponential growth of copies.

But for a polymerase to make a DNA copy, it needs something called a primer. A primer is a short DNA sequence that is complementary to the sequence of the target DNA. And that primer being of a sequence that matches a particular target’s sequence is what makes PCR so specific and able to detect viral cDNA (i.,e., RNA) among so much other contaminating cDNA.

Let’s take a look at that complementary sequence in a little more detail.

Since we know that the RNA sequence contains information that distinguishes the SARS-CoV-2 coronavirus from other viruses, as well as from every living thing, we want a test (PCR) that takes advantage of that informational specificity. RNA is composed of a four-letter code arranged in a particular sequence. Let me show you part of the RNA sequence that encodes the spike S protein as an example (the full sequence is in the link below):

ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAAC — (SARS-CoV-2 RNA sequence)

Each three letters of the RNA or DNA sequence encodes a specific amino acid. For example, the first three letters of the sequence above, ATG, encodes the amino acid methionine (abbreviated M). When you see a sequence of a protein, you will see a long sequence of twenty different letters, not just four like our RNA code above.

The RNA sequence for the same S protein but in the SARS-CoV-1 virus is listed in this link:

The first line of the SARS-CoV-1 S protein RNA sequence is as follows:

ATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCAC — (SARS-CoV-1 RNA sequence)

Let’s line up the first line of both viral S proteins next to each other

ATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCAC (SARS-CoV-1 RNA sequence)

ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAAC — (SARS-CoV-2 RNA sequence)

I bolded the letters that differ between these two closely related viral species.

Recall that for DNA, the letters of the DNA sequence bind in pairs: T:A and C:G.

Primers bind to specific sequences and differences in the sequence between two closely related coronaviruses mean that primers can be designed to specifically detect one versus another.

That sequence specificity is what enables PCR to precisely pick out a viral cDNA from all the other cDNA from whatever sources happened to be up my nose, including my own.

If there are no viral RNA (or cDNA) sequences, during the PCR reaction the primers have nothing to bind to, and no DNA copies are made.

But if there are even a few viral RNA copies in the nasal swab sample, the primers will bind to them and become amplified, and we will be able to detect the presence of so many copies of DNA.

There we have it in a nutshell… the nasal swab sample goes through an RNA extraction step where we purify RNA from all the other nose goop, followed by reverse transcription (RT) where we make a stable analyzable cDNA from all RNA in the purified sample, and last by polymerase chain reaction (PCR) which amplifies a specific cDNA depending on the primers used. This is why you see the RT-PCR acronym popping up everywhere. Hopefully that explanation sheds a little light on what happens to that nasal swab — and will make an unpleasant experience a little less traumatic.

Science
Biotechnology
Coronavirus
Covid-19
Health
Recommended from ReadMedium